Background：
a-thalassemia is a common hereditary disease in Taiwan. Affected patients always carry a heavy burden of morbidity and early death. Prenatal diagnosis has reduced the disease burden on families and the health care system. This study evaluated a new non-radioactive Southern blotting hybridization method for prenatal diagnosis of this disease.
Methods：
Seventy two chorionic villi samples (CVS) and 30 amniocyte samples from 102 pregnancies of couples who were both heterozygous for a-thalassemia-1 of the Southeast Asian (SEA) type deletion were studied. A non-radioactive Southern blotting hybridization method using a dig-alkaline phosphate detection system was developed for use in this study.
Results：
Non-radioactive Southern blotting hybridization data showed that 19 (26%) CVS and five (17%) amniotic fluid samples had 10Kb and 4Kb fragments, indicating homozygosity of the a-thalassemia-1 SEA type deletion. DNA samples were extracted from most of the aborted tissue of the 24 fetuses with a diagnosis of homozygous for the a-thalassemia-1 SEA type deletion. Homozygosity for a-thalassemia-1 SEA type deletion was reconfirmed by Southern blotting hybridization in all of these samples.
Conclusion：
The non-radioactive Southern hybridization protocol used in this study allows efficient and accurate early prenatal diagnosis of a-thalassemia-1 SEA type deletion. It can be routinely used for testing couples who both carry the a-thalassemia-1 SEA type deletion. (Chang Gung Med J 2003;26:20-5)
Keywords：
non-radioactive southern blotting hybridization, a-thalassemia-1, chorionic villus sampling, genetic amniocentesis.

METHODS

From December 1995 through March 2001, pregnant women with mean corpuscular volume (MCV) <80fl, hemoglobin (Hb) A2<3.5% and normal serum ferritin at Chang Gung Memorial Hospital were transferred to the high risk pregnancy center. They were encouraged to undergo molecular screening tests for a-thalassemia along with the fathers of the fetuses. The carrier status of the couples was verified using results of the a-thalassemia screening program at the Chang Gung Medical Center in Lin-Kou, Taiwan.
When both the father and the mother were found to carry the SEA deletion, chorionic villus sampling or genetic amniocentesis was suggested to test for fetal a-thalassemia.
For the detection of a-thalassemia-1 carriers of the SEA type, 3 ml blood samples of both parents were collected antecubitally. DNA was extracted using a commercial kit (Qiagen, Germany). Polymerase chain reactions (PCR) were performed to detect the (--SEA/) genotype using the S1, S2, and S3 primer combination as described by Ko et al.(15) The relative primer positions are shown in Figure 1. Reactions were carried out in a total volume of 50 ml which contained 300 ng of DNA, 200 mM each of dATP, dTTP, dCTP, and dGTP, 20 pmol each of primer S1 and S2 or S1 and S3, 1 U hot start Taq polymerase (Qiagen, Germany), and 5 ml of 10X buffer. Primer sets (L:CTGTCTTGTAACCTTGATACC; R: TGAAGTCCAACTCCTAAGCCA) specific for human b-globin gene, generating a 338 bp fragment, were used as internal controls for the PCR.
For detection of Hb Bart's hydrops in couples carrying the (--SEA/) deletion and avoidance of radioactive waster, a non-radioactive Southern blotting hybridization method using a dig-alkaline phosphate detection system was developed. Genomic DNA was extracted from chorionic villi or cultured amniocyte samples using a commercial kit (Qiagen, Germany). Fifteen micrograms of DNA samples were digested in 20 units of Acc 65 and Bg1 (Biolab, USA) overnight at 37oC according to the conditions recommended by the manufacturer. The digested DNA was fractionated with a 0.75% agarose gel in 1X TBE buffer (Ameresco) and transferred to a Hybond N+ membrane (Amersham) using standard Southern blotting procedures.(16) After 2X washing with 2X SSC (1X SSC=0.3 M NaC1, 0.03 M sodium citrate), the DNA was UV-crosslinked to the membrane and subjected to hybridization with the f zglobin gene probe.(17)
The f zglobin gene probe (Fig. 1) was prepared using PCR. The reaction was carried out in a total volume of 50 ml containing 20 ng of pBam 6.8 plasmid, 10 pmol of each primer (M13, direct: GTAAAACGACGGCCAGT; reverse: CAGGAAACAGCTATGAC), 5 ml of 10X buffer, 5 ml of Q solution (Qiagen, Germany), 200 nM each of the dNTP, and 2 U of hot start Taq DNA polymerase (Qiagen, Germany). After preheating at 95oC for 15 min, the mixture was cycled 30 times for denaturation (94oC, 1 min), annealing (55oC, 1 min), and elongation (72oC, 2 min). An additional 10 min period at 72oC was added at the end of the last cycle. Fifteen ml of the PCR products (~500bps) were resolved with a 2% agarose gel. The DNA was retrieved from the agarose block with 600 ml H2O and used as a template in the secondary PCR. Reaction conditions of the secondary PCR were the same as above except for the addition of 5 ml of 10X Dig DNA labeling mixture (Boeringer Mannheim, Germany). The secondary PCR products were subjected to purification using a gel extraction kit (Qiagen, Germany). The prepared probe was stored in -20oC until used.

RESULTS

One hundred and two pregnancies with increased risk of Hb Bart's hydrops because both partners carried the a-thalassemia-1 SEA type deletion were included in the study (Fig. 1, lanes 1 to 5). The median maternal age was 26 years (range, 16-37 years). Of these pregnancies, 72 received CVS at 9 to 12 weeks (median, 11 weeks) of gestation and 30 received genetic amniocentesis at 15 to 18 weeks (median, 16 weeks) of gestation. Among the 72 CVS samples and the 30 amniocyte samples analyzed, non-radioactive Southern blotting hybridization showed that 19 of the CVS samples and five of the amniotic fluid samples had 10 Kb fragments, indicating homozygosity of a-thalassemia-1 SEA type deletion (Fig. 2).
Thirty one of the 72 CVS samples and 17 of the 30 amniotic fluid samples had 12 Kb, 10 Kb, and 4 Kb fragments, indicating their heterozygous genotypic composition for the a-thalassemia-1 SEA type deletion (Fig 2). Twenty-two CVS samples and eight amniotic fluid samples had only the 12 Kb and 4 Kb fragments, revealing a normal a-globin genotype free of the a-thalassemia-1 SEA type deletion (Table1).
Among the 48 heterozygous pregnancies and 30 pregnancies of normal genotype, no complications associated with a-thalassemia-1 were noted at birth or postnatally. All of the 24 fetuses with a diagnosis of homozygous for the a-thalassemia-1 SEA type deletion using the non-radioactive Southern blotting hybridization were terminated at the request of the parents. DNA samples were extracted from all of the aborted fetuses and homozgosity of a-thalassemia-1 SEA type deletion was reconfirmed in all of them using Southern blotting hybridization.
DISCUSSION

In Taiwan, PCR has been used as a diagnostic tool for the rapid detection of a-thalassemia-1 SEA deletion.(15,18) In 1996, Cheung et al. reported successful prenatal diagnosis of thalassemia using PCR analysis of fetal cells in maternal blood.(19) However, this approach must be simplified to keep costs down and to reduce the level of technical expertise required to obtain reliable results. Although PCR can be used even with trace amounts of DNA, the presence of maternal cell contamination in the CVS or amniotic fluid samples make the results difficult to interpret. Therefore, an alternative protocol using conventional Southern blotting hybridization for prenatal diagnosis of this disease was proposed.(15,17) This protocol analyzed genomic DNA directly without PCR amplification, thus, the influences of potential maternal cell contamination are avoided.
Because conventional Southern blotting hybridization uses radioactive material such as 32P-labeled probes to detect the fragments, it is not feasible in many clinical laboratories since handling radioactive waste is costly and creates the additional problem of exposure of the laboratory technicians to radiation. The non-radioactive Southern blotting hybridization protocol for the detection of a-thalassemia-1 SEA type developed for this study avoids the problems of the conventional methods. The technique uses digoxigenin-dUTP (Boeringer Mannheim) in the synthesis of the f z-globin gene probe.(17) After hybridzation, the detection is performed using alkaline phosphatase-conjugated anti-dig antibody and disodium 3-(4-methoxyspiro{1, 2-dioxitane-3, 2'-(5'-chloro) tricyelo [3.3.1.1] decan}-4-y 1) pheny 1 phosphate (Roche) as the substrate. Chemiluminescence is captured on Kodak Biomax film.
In our study, 24 of 102 CVS or amniotic fluid samples were homozygous for the a-thalassemia-1 SEA type deletion and all of these cases were re-confirmed using Southern blotting hybridization performed on DNA extracted from aborted tissue after termination of the pregnancies. However, PCR data for the nine CVS and one amniotic fluid samples with homozygous a-thalassemia-1 SEA type showed that the deletion was present in only one of the a-globin gene alleles. This finding is not concordant with the results of the Southern blotting hybridization. Thus, maternal cell contamination was likely to be the cause of the false negative PCR results. These results suggest that although the PCR-based protocol is useful in the identification of a-thalassemia-1 SEA type carriers, it might not be appropriate for use in prenatal diagnosis with CVS or amniotic fluid samples.
During the past 25 years, there have been important advances in the management of individuals with a-thalassemia. Available treatment options include prenatal red blood cell transfusion, pharmacologic interventions to increase fetal hemoglobin levels, and stem cell transplantation.(20) Improvement in these approaches and the development of means to replace defective genes with normal ones using gene transfer techniques offer hope for the future, but management-associated complications, expense, and a paucity of suitable donors have limited their application.(21) The lack of a widely available and effective treatment indicates the necessity for disease prevention. Genetic analysis of fetal tissues, ammiocytes or blood for early identification of Hb Bart's hydrops fetalis allows elective termination of affected pregnancies. In Hong Kong where is also a high prevalence area of a-thalassemia, a community-based screening program and prenatal diagnosis for high risk couples have reduced the disease burden to families and to the public health care system.(22)
In conclusion, we have successfully developed a non-radioactive Southern blotting hybridization protocol for prenatal diagnosing of a-thalassemia-1 SEA type. The technique is a useful routine test for couples when both partners carry the a-thalassemia-1 SEA type deletion.

REFERENCES

1. Ko TM, Hsieh FJ, Chen CJ, Hsu PM, Lee TY. Cord blood screening for a-thalassemia in northern Taiwan. J Formos Med Assoc 1998;87:146-9.
2. Lauer J, Shen CK, Maniatis T. The chromosomal arrangement of human alpha-like globin genes: sequence homology and alpha-globin gene deletions. Cell 1980;20:119-30.
3. Michelson AM, Orkin SH. Boundaries of gene conversion within the duplicated human alpha-globin genes. Concerted evolution by segmental recombination. J Biol Chem 1983;258:15245-54.
4. Hatton CS, Wilkie AO, Drysdale HC, Wood WG ,Vickers MA, Sharpe J, Ayyub H, Pretorius IM, Buckle VJ, Higgs D. Alpha-thalassemia caused by a large (62 kb) deletion upstream of the human alpha globin gene cluster. Blood 1990;76:221-7.
5. Ottolenghi S, Lanyon WG, Paul J, Williamson R, Weatherall DJ, Clegg JB, Pritchard J, Pootrakul , Boon WH. Gene deletion as the cause of a-thalassemia. Nature 1974;251:389-92.
6. Taylor JM, Dozy A, Kan YW, Varmus HE, Lie-Injo LE, Ganesan J, Todd D. Genetic lesion in homozygous-thalassemia (hydrops fetalis). Nature 1974;251:392-3.
7. Lin CC, Chang WT, Gutman L, Wei PY. Hydrops fetalis in Taiwan. Int J Gynaecol Obstet 1971;9:157-61.
8. Thumasathit B, Nondasuta A, Silpisornkosol S, Lousuebskul B, Unchalipongse P, Mangkornkanok M. Hydrops fetalis associated with Bart's hemoglobin in northem Thailand. J Pediatr 1968;73:132-8.
9. Liang ST, Wong VC, So WW, Ma HK, Chang V, Todd D. Homozygous a-thalassemia: Clinical presentation, diagnosis, and management. A review of 46 cases. Br J Obstet Gynaecol 1985;92:680-4.
10. Tan SL, Tseng AMP, Thong PW. Hydrops fetalis: Clinical presentation and management: An analysis of 25 cases. Aust NZJ Obstet Gynaecol 1989;3:233-7.
11. Ko TM, Hsieh FJ, Hsu PM, Lee TY. Molecular characterization of severe a-thalassemia causing hydrops fetalis in Taiwan. Am J Med Genet 1991;39:317-20.
12. Weatheral DJ. The thalassemias. In: Beutler E, Lichtman Ma, Coller Bs, Kipps TJ, eds. Williams hematology. 5th ed. New York: McGraw-Hill, 1995:581-615.
13. Higgs DR. (alpha)-Thalassaemia. Baillieres Clin Haematol 1993;6:117-50.
14. Nakayama R, Yamada D, Steinmiller V, Hsia E, Hale RW. Hydrops fetalis secondary to Bart hemoglobinopathy. Obstet Gynecol 1986;67:176-80.
15. Ko TM, Tseng LH, Hsieh FJ, Hsu PM, Lee TY. Carrier detection and prenatal diagnosis of a-thalassemia of Southeast Asian deletion by polymerase chain reaction. Hum Genet 1992;88:245-8.
16. Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 1975;98:503-17.
17. Ko TM, Hsieh FJ, Hsu PM, Lee TY. Prenatal diagnosis of Chinese homozygous a-thalassemia-1 and hemoglobin H disease by analysis of a and f z-globin genes in chorionic villi and amniocytes. Prenat Diag 1989;9:715-25.
18. Chang JG, Lee LS, Lin CP, Chen PH, Chen CP. Rapid diagnosis of a-thalassemia-1 of Southeast Asia type and hydrops fetalis by polymerase chain reaction. Blood 1991;78:853-4.
19. Cheung MC, Goldberg JD, Kan YW. Prenatal diagnosis of sickle cell anemia and thalassemia by analysis of fetal cells in maternal blood. Nat Genet 1996;14:264-8.
20. Flake AW, Zanjani ED. In utero hematopoietic stem cell transplantation: ontogenic opportunities and biologic barriers. Blood 1999;94:2174-91.
21. Mentzer WC. Bone marrow transplantation for hemoglobinopathies. Curr Opin Hematol 2000;7:95-100.
22. Lau YL, Chan LC, Chan YY. Prevalence and genotypes of alpha-and beta-thalassemia carriers in Hong Kong-implications for population screening. N Engl J Med 1997;336:1298-301.

From the Department of Obstetrics and Gynecology, Chang Gung Memorial Hospital, Taipei.
Received: Feb. 28, 2002; Accepted: Aug. 30, 2002
Address for reprints: Dr. Jenn-Jeih Hsu, Department of Obstetrics and Gynecology, Chang Gung Memorial Hospital. 199, Tung-Hwa North Road, Taipei 105, Taiwan, R.O.C. Tel.: 886-2-27135211 ext. 3345; Fax: 886-2-27197368; E-mail: jjhsu@ms6.hinet.net